glutathione uv vis spectrum Quantitative real-time imaging of Discrimination and Quantification of Glutathione

Electron transport and oxidative phosphorylation

sgRNA constructs and gene expressing codon optimized (OPT) plasmid constructs sgRNA control and constructs against CBS and L2HGDH were designed targeting GTATTACTGATATTGGTGGG (sgControl) (#230080, Addgene), GGAGCAGACAACCTACGAGG (sg CBS -1) (#230081, Addgene), TGGCAGTGCTGGCAGCACGG (sg CBS -2) (#230082, Addgene), GATATAGTCATCGTTGGTGG (sg L2HGDH -1) (#230083, Addgene), and CACCAGACTGGACATAACAG (sg L2HGDH -2) (#230084, Addgene) and constructed in lentiCRISPR v2-Blast (#83480, Addgene) for Blasticidin selection at a final concentration of 5 g/ml

You might like these

Is it OK to Take Glutathione Every Day